2017-05-21 19:48:192025-03-30 13:53:57
locus
BSU00880
BSU_00880
geneLength
1080
1083
outlinks
bsu
BSU00880
BSU_00880
Gene
Coordinates
107,476 → 108,558
107,476 108,558
Gene
Phenotypes of a mutant
a [[gene|cdaA]] [[gene|disA]] double mutant or [[gene|cdaA]] [[gene|cdaS]] [[gene|disA]] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
a [[gene|cdaA]] [[gene|disA]] double mutant or [[gene|cdaA]] [[gene|cdaS]] [[gene|disA]] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
reduced spore survival after infrared exposure [pubmed|28961460]
altered morphology on MSgg medium [pubmed|29588402]
plant root colonization defect [pubmed|29588402]
RNA
Catalyzed reaction/ biological activity
2 ATP --> c-di-AMP
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
binds [[protein|RecA]] to inhibit its activity [pubmed|30916351]
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
The protein
Protein family
disA family (according to Swiss-Prot)
DisA family (single member, according to UniProt)
The protein
[SW|Domains]
contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
[SW|DAC domain] (aa 11-149) (according to UniProt)
The protein
[SW|Localization]
see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
forms rapidly moving focus that pauses at [[protein|RecA]]-mediated recombination intermediates upon induction of DNA damage during spore development [pubmed|30916351]
Biological materials
Mutant
MGNA-B932 (yacK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]
GP2142 (''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab
BKG2 (''[[gene|radA]]-[[gene|disA]]::spc''), available in [SW|Jörg Stülke]'s lab
1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
MGNA-B932 ([[gene|disA]]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]
GP2142 (''Δ''''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab
BKG2 (''[[gene|radA]]-[[gene|disA]]::spc''), available in [SW|Jörg Stülke]'s lab
1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC [[gene|disA]]::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE00880 ([[gene|disA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
BKK00880 ([[gene|disA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
GP2715 (''Δ''''[[gene|disA]]''::''spc''), available in [SW|Jörg Stülke]'s lab
GP2752 (''Δ''''[[gene|disA]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP2782 (''Δ''''[[gene|disA]]''::''kan''), available in [SW|Jörg Stülke]'s lab
Biological materials
Expression vector
IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab
References
Reviews
References
Original publications
The protein
Paralogous protein(s)
[[this]]
The protein
[SW|Cofactors]
Mn2+ [pubmed|26014055]
Biological materials
Expression vectors
IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab